Javascript detect browser type

1. Problem:

Sometimes there are different present in the different browser, especially in IE and firefox-like. In this we should get the browser type and do the different method

2. Solution

/* To get the browser type */
function detectIsIEBrowser(){
    var isIE = false;
    var val = navigator.userAgent.toLowerCase();
   
    if(val.indexOf("msie") > -1) {
        isIE = true;
    }
    return isIE;
   
}




Reference
Basic
Advance_PPK

YUM Repository

1.The YUM path
 YUM is a easy management software tools, and mostly the
repository  files will in /etc/yum.repos.d/ and the config file in /etc/yum.conf

2. Useful yum commands

• yum search tools-name
• yum install tools-name
• yum info tools-name
• yum list installed
• yum clean

3.  Useful yum repository

in my CentoOS 6.2, I use the following repo

• CentOS-Base.repo
• CentOS-Debuginfo.repo
• CentOS-Media.repo
• mirrors-rpmforge
• mirrors-rpmforge-extras
• mirrors-rpmforge-testing
• rpmforge.repo

4.  Advance isuuses

• How to new a repository??
• Taiwan's usefully repository.

CLC Bio about NGS develop

RNA Ploy A tail

From: Ploy(A) Tail

The Poly(A) Tail

As illustrated in the following figure, a generic messenger RNA (mRNA) consists of a number of distinct features, each of which has different functions. The very 5’-end* of the mRNA has a so-called cap (the chemical structure of which is shown in the figure). The most recognizable part of the mRNA is the open-reading frame; this is the series of nucleotides that are “read” by ribosomes to yield the polypeptide that is coded by the mRNA. The open reading frame begins (almost always) with the nucleotide triplet AUG, and ends (after a number of nucleotides that is a multiple of three) with one of the three “stop codons” (UAA, UAG, UGA). At the 3’-end* lies a tract of adenosines – between 90 and 300 or so, at the outset of the life of an mRNA. Finally, the regions of the mRNA between the cap and open reading frame, and between the open reading frame and poly(A) tail, are designated as the 5’- and 3’- untranslated regions, or UTRs.

These different features all interact with other cellular factors; the complete story fills large review volumes, and I won’t bother to try and describe everything. However, it is important for this overview to note that the cap is bound by a so-called cap-binding complex, and the poly(A) tail by a poly(A)-specific RNA binding protein (the poly(A)-binding protein, or PAB). As a single PAB binds only 12 or so nucleotides, the poly(A) tail is “coated” with a number of PAB subunits.

The poly(A) tail functions in two ways. It promotes translation of the mRNA by ribosomes, via a process that is briefly sketched in the following figure. The poly(A) tail, via PAB, actually is “connected” with the cap of the mRNA, via interactions of PAB and the cap-binding complex with other translation initiation factors. This serves to circularize the mRNA-protein complex as shown, and to stabilize the interactions at the 5’-end of the mRNA. The cap-binding complex and other translation initiation factors eventually recruit the small (40S) ribosomal subunit to the vicinity of the cap; this subunit and some of the initiation factors then scan along the mRNA until it finds a suitable AUG triplet, whereupon the 60S ribosomal subunit, initiator tRNAs, and other factors come into play to begin the process of translation.

Remove or unlink the symbolic link

1. What ??
General I often to use the unlink to remove the symbolic links,
but when there are many links file in a folder,
is there any of quick method to do that ??



2. Solution:
A. Write a batch to unlink the symbolic link.

B. Use rm when there are no any physical files in this
rm reference

      If file is a symbolic link, then only the symbolic link is removed.
      The file or directory pointed to by the symbolic link is not affected.
      If any of the intermediate path components of file happens to be a
      symbolic link, then rm follows the symbolic link and removes the file.

Reference: How to Unlink all files in a directory?

illumina experiment

www.perkinelmer.com/pdfs/downloads/CST_RGHS_UK_NGS_Magrini.pdf
1. We sholud the data content Reference: NGS Sample Prep Challenges

Transcription factor

1. What Transcription factor  ??

In molecular biology and genetics, a transcription factor (sometimes called a sequence-specific DNA-binding factor) is a protein that binds to specific DNA sequences, thereby controlling the flow (or transcription) of genetic information from DNA to mRNA.Transcription factors perform this function alone or with other proteins in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase (the enzyme that performs the transcription of genetic information from DNA to RNA) to specific genes


Referencee:
wiki
Advance

illumin read and phred 33

Illumina reads:

@ + [Read Name] + [Paried_Direction(1/2)]

@HWI-ST688:211:C0F02ACXX:6:1101:12568:67545 2:N:0:AGTCAA

GGGAGGAAGGTGCAGGTCCCTCTGCCCTTTCTGCCAAGGTGCAGAATAGCGCCCGGGCGTGTGTTTTGGCTCCAGAGCAGTTCCACGTGGAGCAACTTCGT

+

BCCFFFFFHHFHHJJJHIJJJJJJJJJIJJJJJJJJIJJ?FGHJGIGIHIGGHIIJHHD>@;AACDDDD:ACDDDDDDDDCDDDEDDBDDBDDBDDDDD@#

@HWI-ST688:211:C0F02ACXX:6:1101:12568:67545 1:N:0:AGTCAA

CCTCCTCACAGATCAAGTACACAACACACACACACACACACACACACACACACGAAGTTGCTCCACGTGGAACTGCTCTGGAACCAAAACACACGCCCGGG

+

CC@FFFFFHHHHHJJJJGIJJJJJIJJJJJIJJJJJJJJJJJIJJJJJJJJIHFEFF?>ACACDCDD?ABDDDCC>ACDCDC(9<ABBBDDDBB>>BB<55

[From http://en.wikipedia.org/wiki/FASTQ_format]

--------------------------------

TruSeq / Quality 101 / Quality Scores Overview

Quality Scores

Quality scores measure the probability that a base is called incorrectly. With SBS technology, each base in a read is assigned a quality score by a phred-like algorithm1,2, similar to that originally developed for Sanger sequencing experiments. The quality score of a given base, Q, is defined by the equation

Q = -10log10(e)

where e is the estimated probability of the base call being wrong. Thus, a higher quality score indicates a smaller probability of error. In the table below, a quality score of 20 represents an error rate of 1 in 100, with a corresponding call accuracy of 99%.

The Relationship Between Quality Score and Base Call Accuracy Quality Score Probability of Incorrect Base Call Inferred Base Call Accuracy

10 (Q10) 1 in 10 90%

20 (Q20) 1 in 100 99%

30 (Q30) 1 in 1000 99.9%

From [http://www.illumina.com/truseq/quality_101/quality_scores.ilmn]

Phred 33:

How are qualities scaled?

Q = ord(q) - 33

q = chr(Q+33)

Q  integer quality

q  character representation

[From http://www.google.com/url?q=http://faculty.washington.edu/jht/GS373_2010/lectures/G373_Shendure_Wk9_Monday_lec24.pdf&sa=U&ei=-4fBULi5DM6WmQWc9YCgDA&ved=0CBcQFjAA&sig2=cLOTAx1vQje5eSYCseyaOg&usg=AFQjCNFWi32peUKA4MaYr6_dEEGgGDD7WA]

Primer and random primer

1. What is a primer?

A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing.  These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal.   

Reference: What is a primer

2. What is a random primer?? 

Random primers are short segments of single-stranded DNA (ssDNA) called oligonucleotides, or oligos for short. These oligos are only 8 nucleotides long (octamers) and they consist of every possible combination of bases which means there must be 4⁸ = 65,536 different combinations in the mixture. Because every possible hexamer is present, these primers can bind to any section of DNA.

 Reference: random primer

3. More about primer

The only issue worth mentioning now is that three different types of primers can be used (figure 3). 1) 

• If the mRNA has a poly-A 3' tail, then an oligo-dT primer can be used to prime all mRNAs simultaneously. 2) 

• If you only wanted to produce cDNA from a subset of all mRNA, then a sequence-specific primer could be used that wil only bind to one mRNA sequence. 3) 

• If you wanted to produce pieces of cDNA that were scattered all over the mRNA, then you could use a random primer cocktail that would produce cDNA from all mRNAs but the cDNAs would not be full length. 

The major benefits to random priming are the production of shorter cDNA fragments and increasing the probability that 5' ends of the mRNA would be converted to cDNA. Because reverse transcriptase does not usually reach the 5' end of long mRNAs, random primers can be beneficial

Reference: primer and CDNA

CDS and exon relationship

1. what is cds?

the gene coding sequence. and is composed of many exon.

Refernece:
What's the difference between CDS and ORF?

Sensitive and specific Reference

1. 究的實驗分析：敏感性、特殊性

2. P-value 的 Multiple test correction

SAM file format

1. About SAM format

SAM is (Sequence Alignment/Map) format

2. Field introduction
Office File



3. Flag expalin
  read paired
  read mapped in proper pair
  read unmapped
  mate unmapped
  read reverse strand
  mate reverse strand
  first in pair
  second in pair
  not primary alignment
  read fails platform/vendor quality checks
  read is PCR or optical duplicate
Reference: Web SAM Flag



3. Example
 Reference: Detail Example



4. Paired-End Flag

• 163: read paired, read mapped in proper, mate reverse, second in pair
• 83  : rad paired, read mapped in proper, read reverse, first in pair

• 67: read paired, read mapped in proper, fist in parir
• 131: read paired, read mapped in proper, second in pair 

• 99: read pair, read mapped in proper, mate reverse, fist in pair
• 147: read pair, read mapped in proper, read reverse, second in pair

5. Paired insert length calculation
 Reference: Paired insert length